le clonage moléculaire et l’épitope …

le clonage moléculaire et l'épitope ...

clonage et épitope moléculaire analyse de l’arachide allergène Ara h 3

1 Département de biochimie et de biologie moléculaire, et 2 Département de pédiatrie, Université de l’Arkansas pour les sciences médicales, Hôpital Institut de recherche de l’Arkansas Children, Little Rock, Arkansas 72205, États-Unis 3 Département de pédiatrie, école Mount Sinai Medical, New York, New York 10029 , ETATS-UNIS

Adresse de correspondance: Gary A. Bannon, Université de l’Arkansas pour les sciences médicales, Slot 516, 4301 W. Markham, Little Rock, Arkansas 72205, États-Unis. Téléphone: (501) 686-5787; Fax: (501) 686-8169; E-mail: ude.smau.egnahcxe@ayragnonnaB

Reçu le 28 septembre 1998; Accepté 1999 1 janvier

droits d’auteur &# X000a9; 1999, American Society for Clinical Investigation

Cet article a été cité par d’autres articles dans PMC.

Abstrait

L’allergie aux arachides est un important problème de santé IgE-médiée en raison de la prévalence accrue, la gravité potentielle, et la chronicité de la réaction. Suite à notre caractérisation des deux allergènes d’arachide Ara h 1 et Ara h 2, nous avons isolé un clone d’ADNc codant pour un troisième allergène d’arachide, l’Ara h 3. La séquence d’acides aminés déduite de l’Ara h 3 montre une homologie avec 11S des protéines de graines de stockage. La forme recombinante de la protéine a été exprimée dans un système bactérien et a été reconnu par les IgE sériques d’ &# X0223c; 45&# X00025; de notre population de patients allergique aux arachides. IgE sériques provenant de ces patients et, des peptides synthétiques se chevauchant ont été utilisés pour cartographier les linéaires, des epitopes de liaison aux IgE d’Ara h 3. Quatre épitopes, entre 10 et 15 acides aminés de longueur, ont été trouvés dans la séquence primaire, sans aucun motif de séquence évidente partagée par les peptides. Un épitope est reconnu par tous Ara h 3&# X02013; patients allergiques. l’analyse mutationnelle des epitopes a révélé que des changements d’acides aminés uniques au sein de ces peptides pourraient conduire à une diminution ou une perte de liaison aux IgE. En déterminant quels acides aminés sont essentiels pour la liaison de l’IgE, il pourrait être possible de modifier l’Ara h 3 ADNc pour coder pour une protéine avec une capacité de liaison aux IgE réduite. Ces résultats permettront à la conception de l’amélioration des approches diagnostiques et thérapeutiques pour des réactions alimentaires hypersensibilité.

introduction

L’allergie aux arachides est une préoccupation majeure de santé en raison de la gravité de la réaction allergique, la persistance de la réponse allergique pendant toute la durée de vie de l’individu, et l’utilisation omniprésente de l’arachide comme un supplément de protéines dans les aliments transformés. Les réactions d’hypersensibilité alimentaire affectent &# X0223c; 8&# X00025; des enfants et 1&# X00025;&# X02013 2;&# X00025; des adultes (1. 2). Arachides, les noix, et les mollusques sont responsables de la majorité des réactions d’hypersensibilité alimentaire chez les adultes, alors que les arachides, le lait et les œufs représentent la majorité des réactions chez les enfants (3). La réaction à l’arachide est généralement plus grave que la réaction à d’autres aliments, entraînant souvent une anaphylaxie fatale. Bien que la plupart des enfants surmontent allergiques au lait et les œufs, les allergies aux arachides persistent à l’âge adulte, d’une durée de la vie entière de l’individu (4). À l’heure actuelle, l’évitement est le seul traitement pour les patients allergiques aux arachides. Malheureusement, l’inclusion d’arachide comme un supplément de protéines dans les aliments transformés rend la consommation accidentelle presque inévitable. Malgré la prévalence de l’hypersensibilité à l’arachide chez les enfants et un nombre croissant de décès chaque année à partir de l’anaphylaxie induite par l’arachide, l’identification et la caractérisation de unique, allergènes cliniquement pertinentes de l’arachide sont incomplètes, ce qui limite notre compréhension de leur rôle dans l’immunobiologie des réactions d’hypersensibilité.

L’exposition à un allergène induit la production d’anticorps IgE spécifiques de l’allergène et le développement ultérieur d’une réaction allergique chez des individus atopiques (5). Au cours des dernières années, un certain nombre d’allergènes ont été identifiés qui stimulent la production d’IgE et provoquer une maladie médiée par les IgE (6 &# X02013; 9). Bien que beaucoup d’information existe sur l’identification, la purification et le clonage des allergènes inhalés (pollens, les acariens, les squames d’animaux, les insectes et les champignons), quelques allergènes alimentaires ont été identifiés et étudiés.

L’arachide (Arachis hypogaea ) Est un membre de la famille des légumineuses (Leguminosae), qui comprend le soja, jack bean, haricot de Lima, et le pois (10). actions d’arachide de nombreuses réactions croisées des protéines avec ces autres membres; cependant, l’ingestion de ces autres légumineuses provoque rarement une réaction clinique chez les patients allergiques à l’arachide (11). Pour identifier les protéines allergènes spécifiques à l’arachide, la réaction croisée des anticorps dirigés contre le soja ont été retirés du sérum de patients allergiques à l’arachide. Ce sérum de soja adsorbé contenant des anticorps IgE propres à l’arachide, des fractions a identifié plusieurs allergènes sur des immunoempreintes aux protéines d’arachide entier (12). Deux de ces fractions, Ara h 1 (63,5 kDa) et Ara h 2 (17 kDa), ont été caractérisées en détail dans notre laboratoire. Ces protéines ont été isolées, et leurs ADNc correspondant a été cloné à partir d’une bibliothèque d’ADNc matures arachide (13. 14). Les deux protéines sont reconnues par les IgE sériques d’ &# X0003e; 90&# X00025; des patients allergiques à l’arachide, les établissant comme allergènes majeurs d’arachide. La reconnaissance des IgE sériques de ces allergènes semble être dû essentiellement à des acides aminés comprenant des epitopes linéaires en l’absence d’hydrates de carbone (14. 15). Une analyse mutationnelle de ces épitopes immunodominants ont révélé que la liaison des IgE peut être abolie par des mutations d’acides aminés uniques dans chaque épitope (14. 15). Ces résultats indiquent que la protéine recombinante peut être envisagée pour une utilisation dans des méthodes diagnostiques et immuno-thérapeutiques à l’hypersensibilité à l’arachide.

Dans cet article, nous rapportons le clonage de l’ADNc codant pour un troisième allergène d’arachide, Ara h 3. Le séquençage de l’Ara h 3 ADNc identifié cet allergène comme une protéine de graines de stockage légumineuse-like. La forme recombinante de cette protéine a été exprimée dans un système bactérien et est reconnu par les IgE sériques de 44&# X00025; (8/18) de notre population de patients d’arachide hypersensible. La séquence d’acides aminés dérivée a été utilisé pour construire des peptides synthétiques destinés à être utilisés pour effectuer une analyse détaillée des epitopes de liaison aux IgE linéaires de cette protéine. Ces résultats permettront à la conception d’approches diagnostiques et thérapeutiques améliorées pour traiter les personnes présentant une hypersensibilité à l’arachide.

Méthodes

Les patients.

Le sérum provenant de patients ayant une hypersensibilité à l’arachide documentée a été utilisé pour sonder la protéine recombinante et d’identifier l’Ara h 3 epitopes de liaison aux IgE. Chaque patient a eu un immédiat test cutané positif à l’arachide et soit un, défi positif à double insu avec placebo ou une histoire convaincante de l’anaphylaxie à l’arachide (œdème laryngé, une respiration sifflante sévère, et / ou hypotension). Une personne avec des niveaux d’IgE sériques élevés (qui ne possèdent pas d’hypersensibilité spécifique à l’arachide IgE ou une exposition d’arachide) a servi de témoin dans ces études. Dans certains cas, un pool de sérum, consistant en des aliquotes égales d’IgE sériques provenant de chacun des patients, a été utilisé dans des expériences d’analyse d’immunobuvardage pour déterminer les caractéristiques de liaison aux IgE de la population. Détails décrivant la procédure de contestation et de la collecte des IgE sériques ont été discutés précédemment (16). Toutes les études ont été approuvées par le Comité consultatif utilisation humaine à l’Université de l’Arkansas pour les sciences médicales.

L’isolement et analyse des acides aminés de la séquence d’arachide allergène Ara h 3.

Des tranches de gel contenant Ara h 3 ont été envoyés au W.M. Fondation Keck (Laboratoire de ressources Biotechnologie, Université de Yale, New Haven, Connecticut, États-Unis) pour le séquençage d’acides aminés. Le NH2 -séquence terminale d’acides aminés de l’Ara h 3 a été déterminée en effectuant une dégradation d’Edman sur un Applied Biosystems Inc. (Foster City, Californie, États-Unis) séquenceur en phase gazeuse avec une colonne HPLC en ligne qui a été éluée avec des concentrations d’acétonitrile croissant.

Identification de l’Ara h 3 clones d’ADNc.

Une bibliothèque d’arachide d’ADNc mature a été criblée en utilisant un &# X003b3; -ATP, 5&# X02032; marqué à l’extrémité, dégénéré oligonucléotide 23 pb dérivé du NH2 -la séquence d’acides aminés terminale (ISFRQQPEENA). Les plaques positives ont été soumises à in vivo, l’excision pour éliminer phagemide à partir du vecteur en utilisant le phage auxiliaire R408 (Stratagene, La Jolla, Californie, États-Unis) selon un protocole fourni par le fabricant. Surnageants contenant le phagemide pBluescript excisé conditionnée sous forme de particules de phage filamenteux ont été décantées dans des tubes stériles. Pour la préparation de l’ADN, des phagémides sauvés ont été étalées sur des plaques de LB-ampicilline en utilisant cellules XL-1 bleu et mises en incubation pendant une nuit à 37&# X000b0; C. Les colonies apparaissant sur la plaque contiennent le plasmide double brin pBluescript avec l’insert cloné. ADN a été préparé en utilisant le kit Miniprep plasmide Spin (QIAGEN Inc. Valencia, Californie, USA) et séquence comme décrit plus loin ici. Plusieurs clones ont été identifiés de cette manière, qui ont tous été dépourvu &# X0223c; 300 pb de la 5&# X02032; fin.

L’amplification des extrémités d’ADNc glycinine.

Le PCR ADNc Library Kit CapFinder Construction (CLONTECH Laboratories Inc. Palo Alto, Californie, USA) a été utilisé pour amplifier sélectivement les 5&# X02032; partie de l’ADNc codant pour l’Ara h 3. Poly (A) &# X0002b; L’ARN a été isolé comme décrit précédemment (13). Pour la synthèse d’ADNc premier brin, 0,5 &# X003bc, g-poly (A) &# X0002b; ARN 1 &# X003bc; l CapSwitch oligonucléotide, 5 pmol de 3FA.S. (GCACCTTCTGGTGACTATC), une amorce anti-sens provenant d’un nucléotide présent dans la séquence conservée glycinines, ont été incubées à 72 ° C&# X000b0; C pendant 2 min, puis placé sur de la glace pendant 2 minutes avant d’être ajouté à un mélange de 5&# X000d7; un tampon premier brin, 2 mM de DTT, 1 mM de dNTP et 100 U du virus de la leucémie murine de Moloney transcriptase inverse. Cette réaction se déroule à 42&# X000b0; C pendant 1 h et a été placé sur la glace. Pour amplifier l’ADNc double brin, 2 &# X003bc; l d’ADNc premier brin et 5 pmol de chacune des 3FA.S. et H1 (pour servir comme amorces) ont été ajoutés à un mélange réactionnel contenant 1&# X000d7; tampon PCR KlenTaq, 0,2 mM de dNTP, 1&# X000d7; KlenTaq Polymerase Mix, et dH2 réaction O. Le PCR a commencé avec un 1-min dénaturation à 95&# X000b0; C, suivie par 22 cycles de dénaturation à 95&# X000b0; C et hybridation / élongation de 5 min à 68&# X000b0; C. 5 amplifiée&# X02032; partie de l’Ara h 3 L’ADNc a été clone dans un vecteur pGEM-T par des protocoles standard fournis par Promega Corp. (Madison, Wisconsin, USA).

L’amplification par PCR de la séquence d’ARNm de l’Ara h 3.

deux oligonucléotides &# X02014; Rab-1 (CGNCAGCAACCGGAGGAGAACGC), dérivé de la séquence de nucléotides obtenue à partir de l’amplification sélective de la 5&# X02032; fin de glycinines d’arachide, et T7&# X0002b; (CGACTCACTATAGGGCGAATTGG), un oligonucléotide dérivé de la séquence du vecteur pBluescript &# X02014; servi comme amorces pour une réaction PCR pour amplifier sélectivement la séquence nucléotidique codant pour l’Ara h 3 protéines. La bibliothèque d’ADNc d’arachide mûre a servi comme matrice et a été concentré par extraction au phénol / chloroforme suivie d’une précipitation classique à l’éthanol. Chaque réaction de PCR consistait en 1 &# X003bc; l de banque d’ADNc concentrée, 5 pmol de chaque amorce, dNTP 0,2 mM, et 1,25 U de Taq ADN polymérase. Ces réactions ont été réalisées dans un tampon contenant 3 mM de MgCl2. KCl 500 mM et 100 mM de Tris-HCl (pH 9,0). Après un cycle de dénaturation initiale à 94 ° C&# X000b0; C pendant 2 min, 30 cycles de PCR consistant en une étape de dénaturation de 30 à 94 ° C&# X000b0; C suivie par un recuit à 60&# X000b0; C pendant 30 s et l’allongement à 72&# X000b0; C pendant 1 min ont été réalisées dans un thermocycleur (Perkin-Elmer Corp. Norwalk, Connecticut, États-Unis). Après séparation par électrophorèse sur 1&# X00025; gel et la purification d’agarose, les produits de la taille appropriée ont été insérés dans un vecteur pGEM-T.

Le séquençage d’ADN et l’analyse.

Le séquençage a été réalisé selon les méthodes de Sanger et al. (17) en utilisant des amorces oligonucléotidiques dirigées vers différentes régions du clone et le système de séquençage de cycle femtomole ADN (Promega Corp.). L’analyse de séquence a été réalisée sur l’Université de l’Arkansas pour l’ordinateur Vax de sciences médicales à l’aide du logiciel d’analyse de l’ADN Wisconsin (18).

expression bactérienne et purification de l’Ara h 3 recombinant.

Un ADNc correspondant à la séquence Ara h 3 a été amplifié par PCR et clone dans un vecteur pET. Cette expression plasmidique a permis d’une protéine recombinante qui comprend l’addition de Ala Ser 1. 2. Phe et 3 au NH2 -terminale, trois acides aminés non codés par notre clone. Ser Phe 2 et 3 coïncident avec les acides aminés dans la protéine native; cependant, Ile 1 dans la protéine native a été modifiée en Ala 1 dans le recombinant pour la facilité de l’expression (19). Des amorces pour PCR ont été conçues pour inclure un Nhe Je place au 5&# X02032; de l’ADNc et Sal Je place au 3&# X02032; de l’ADNc. Les amorces utilisées étaient 5&# X02032; -TATGGCTAGCTTCCGGCAGCAACCGGAGGAG-3&# X02032; (5&# X02032; primer) et 5&# X02032; -CCGTCGACAGCCACAGCCCTCGGAGA-3&# X02032; (3&# X02032; apprêt). Les produits de PCR ont été clones dans le Nhe JE/ Sal I sites de restriction du plasmide pET 24 (B) &# X0002b; sous le contrôle du promoteur T7 lac. Ce vecteur d’expression contient le gène codant pour la résistance à la kanamycine et une séquence codant pour un His6 étiquette produite à l’extrémité COOH-terminale de la protéine recombinante. L’expression des protéines dans le Escherichia coli la souche BL21 (DE3) a été induite par l’addition d’isopropyl-B – D -thiogalactopyranoside à une concentration finale de 1 mM, une fois que la culture a atteint une600 &# X0003d; 0.6. Les cellules ont été récoltées à des intervalles de 1 h, remises en suspension dans du tampon d’échantillon SDS contenant du DTT et on fait bouillir à 100&# X000b0; C pendant 5 min. Les échantillons ont été soit utilisés immédiatement pour l’analyse immunoblot, ou les échantillons ont été rassemblées en un culot, lavées avec 50 mM de Tris-HCl, et stockées pour une utilisation ultérieure sous forme de pastille congelée à &# X02013; 70&# X000b0; C.

Recombinant Ara h 3 a été purifiée à partir de lysats bactériens dans des conditions de dénaturation à l’aide du kit de purification His-Bind (Novagen Inc. Madison, Wisconsin, États-Unis). Des extraits cellulaires ont été remis en suspension dans 4 ml de tampon de liaison froid (mM d’imidazole 5, 0,5 M de NaCl, 20 mM de Tris-HCl et 6 M d’urée, fournis avec le kit de Novagen), soniquées pour cisailler l’ADN, et on a incubé sur de la glace pendant 1 h. Ensuite, le lysat a été centrifugé à 12.000 g pendant 45 min pour éliminer les débris cellulaires. Le surnageant a été préparé postcentrifugation pour le chargement sur la colonne, en le faisant passer à travers un 0.45-&# X003bc; membrane m à l’aide d’un filtre seringue-end. A His-Bind colonne rapide (Novagen) a été emballé avec de la résine de chélation de métal His-Bind, lavé avec désionisée H2 O, et chargé jusqu’à saturation avec la charge tampon (mM NiSO 504 ; Novagen). Après équilibrage de la colonne avec un tampon de liaison, 2 volumes de surnageant ont été chargés sur la colonne. La colonne a été lavée avec 10 volumes de tampon de liaison et 6 volumes de tampon de lavage (20 mM d’imidazole, 0,5 M de NaCl, 20 mM de Tris-HCl et 6 M d’urée). L’élution a été réalisée avec 5 volumes de tampon d’élution (1 M d’imidazole, 0,5 M de NaCl, 20 mM de Tris-HCl et 6 M d’urée; Novagen). Les fractions collectées au cours de l’expérience recombinante contenant l’Ara h 3 ont été lyophilisés et stockés dans une&# X000d7; PBS.

SDS-PAGE, Western blots, et le dosage de liaison aux IgE.

Purifié Ara h 3 recombinant a été analysé par SDS-PAGE en utilisant des éléments préfabriqués 12&# X00025; Tris-glycine gels (Novex, San Diego, Californie, USA). Les échantillons ont été soumis à une électrophorèse pendant 90 min à 125 V. Les protéines ont été visualisées par coloration au bleu de Coomassie, soit, soit en utilisant Gelcode bleuissement Reagent (Pierce Chemical Co. Rockford, Illinois, USA) selon le protocole du fabricant. Pour l’analyse immunoblot, les protéines ont été électrotransfert sur nitrocellulose à 30 V pendant 90 min. Après le transfert, blots ont été bloqués en utilisant une solution contenant du Tris-NaCl et 3&# X00025; BSA. En variante, des membranes de cellulose contenant des peptides synthétiques ont été bloqués dans une solution fournie par Genosys Biotechnologies, Inc. (The Woodlands, Texas, États-Unis). Tous les transferts ont été incubés avec un pool de sérums provenant de patients ayant une hypersensibilité à l’arachide documentée ou sérums individuels dilués (1: 5) dans une solution contenant du Tris-NaCl et 1&# X00025; BSA pendant 16 h à 4&# X000b0; C. L’anticorps primaire a été détecté avec 125I-anticorps marqué anti-IgE (Sanofi Diagnostics Pasteur Inc., Paris, France).

La synthèse des peptides.

Des peptides individuels ont été synthétisés avec fluorénylméthoxycarbonyl (Fmoc) amino-acides sur une membrane de cellulose transformée en dérivé contenant des groupes hydroxyles libres selon les instructions du fabricant (Genosys Biotechnologies). En bref, la synthèse de chaque peptide a commencé par estérification d’un acide aminé Fmoc à la membrane de cellulose. Les réactions de couplage sont suivies par acétylation avec de l’anhydride acétique en N ,N -diméthylformamide pour donner des peptides non réactifs au cours des étapes ultérieures. Après acétylation des groupes protecteurs Fmoc sont éliminés par l’addition de pipéridine à rendre les peptides naissants réactif. Les acides aminés restants sont ajoutés par ce même processus de couplage, blocage, et la déprotection, jusqu’à ce que le peptide souhaité est généré. Lors de l’addition du dernier acide aminé, les chaînes latérales du peptide sont déprotégés avec un mélange 1: 1: mélange de dichlorométhane / acide trifluoreacetic / trilisobutylsilane 0,05 et lavés avec du methanol. Membranes contenant des peptides synthétiques ont été soit sondé immédiatement avec les IgE sériques ou stockés à &# X02013 20;&# X000b0; C jusqu’à utilisation.

Résultats

Le clonage moléculaire et la séquence de l’Ara h 3 ADNc.

Le NH2 -terminale d’une protéine de 14 kDa purifiée identifiée par les IgE sériques de soja adsorbé sur des patients hypersensibles à l’arachide a été utilisé pour le séquençage des acides aminés (12). oligonucléotides dégénérés dérivés de la séquence d’acides aminés ont été utilisés pour cribler une banque d’ADNc d’arachide mature. Les détails concernant les procédures utilisées pour cloner l’Ara h 3 ADNc sont décrites dans les méthodes. La séquence de l’Ara h 3 ADNc et la séquence d’acides aminés déduite sont représentées sur la Fig. &# X200B; Fig. 1. 1. L’Ara h 3 ADNc est un cadre ouvert de lecture de 1530 nucléotides, codant pour 510 acides aminés. Ce cadre de lecture commence par un codon CGG et se termine par un codon d’arrêt TAA à la position nucléotidique 1533. La taille calculée de la protéine codée par ce cadre de lecture ouvert est &# X0223c; 57 kDa. Les 24 acides aminés obtenus à partir de NH2 -Le séquençage terminal de la protéine de 14 kDa correspondent aux acides aminés codés par les nucléotides situés aux extrémités 5&# X02032; fin du clone d’ADNc. La protéine de 14 kDa semble être un groupe NH2 -produit de dégradation terminale d’un allergène plus grande. Ce clone d’ADNc semble manquer l’extrémité 5&# X02032; fin qui code pour un peptide signal et la methionine de l’initiateur. Recherches de base de données pour la similarité de séquence a révélé que l’Ara h 3 ADNc codé une protéine 11S semences de stockage. Ara h 3 a montré 62&# X00025;&# X02013; 72&# X00025; une identité de séquence à partir glycinines glycine max (Soja) et légumines de Pisum satvium (pois). En particulier, 24 des 26 résidus supposés être importants pour la structure tertiaire de ces protéines de stockage (20) sont présents dans la séquence primaire Ara h 3, comprenant un site de clivage conservé à Asn 325 et Gly-326. Il n’y avait pas d’homologie observée entre cet allergène et les autres allergènes majeurs d’arachide déjà identifiés (Ara h 1 ou Ara h 2).

La séquence nucléotidique de l’Ara h 3 clone d’ADNc. La séquence nucléotidique est sur la deuxième ligne. La première ligne représente la séquence d’acides aminés dérivée. les acides aminés encadrés correspondent à la séquence d’acides aminés déterminée à partir du NH2 -terminale de la protéine Ara h 3. .

Expression, antigénicité, et la purification du recombinant Ara h 3.

Ara h 3 L’ADNc a été clone dans un plasmide pET 24 et exprimé dans un système bactérien. expression optimale a été obtenue suite à une induction de quatre heures par isopropylique B- D -thiogalactopyranoside (fig. &# X200B; (2 Fig.2 une. voie F ). Immunoblot sur la Fig. &# X200B; Fig.2 2 b a été effectuée en utilisant des IgE sériques d’un pool de patients présentant une hypersensibilité à l’arachide pour déterminer le poids moléculaire et la spécificité de la liaison aux IgE. À partir de la tache, la taille estimée de la protéine recombinante produite par des cellules bactériennes est &# X0223c, 57 kDa, qui correspond à la masse moléculaire prédite codée par le clone. Figure &# X200B; Figure2 2 c montre 20 bandes d’immunotransfert de purifiée Ara h 3 recombinant incubé avec des sérums de patients différents. Quarante-quatre pour cent (18/08) des patients testés ont des IgE reconnaissant la protéine recombinante (fig. &# X200B; (2 Fig.2 c. voies UNE &# X02013;R ). La différence d’intensité de liaison entre Ara h 3&# X02013, les patients allergiques pourrait être dû à la quantité d’IgE spécifique à l’arachide chez chaque individu ou des différences dans l’affinité de l’IgE spécifique du patient à cet allergène.

expression bactérienne et l’analyse immunoblot de Ara recombinant h 3. (une ) dix-&# X003bc; l échantillons d’extrait bactérien ont été soumis à une électrophorèse dans un 12&# X00025; un gel de Tris-glycine. Les protéines ont été visualisées par coloration de Coomassie bleu. voie UNE. 4 h induction du vecteur .

régions situées dans la protéine Ara h 3 Multiple de liaison aux IgE.

Soixante-trois peptides chevauchants ont été synthétisés afin de déterminer les régions de la protéine Ara h 3 ont été reconnus par les IgE sériques. Chaque peptide synthétisé a été de 15 acides aminés de long et décalé par rapport au peptide précédent en huit acides aminés. Cette approche a permis l’analyse de l’ensemble de l’Ara h 3 séquence primaire dans de grands fragments qui se chevauchent. Ces peptides ont été sondés avec un pool de sérum d’IgE de patients à l’arachide hypersensible qui avait été montré précédemment à reconnaître recombinant Ara h 3. Figure &# X200B; Figure3 3 montre les quatre régions de liaison aux IgE et leur emplacement correspondant dans la séquence d’acides Ara h 3 amino primaire. Ces régions se liant aux IgE ont été représentées par des résidus d’acides aminés 21&# X02013; 55, 134&# X02013; 154, 231&# X02013, 269 et 271&# X02013; 328.

régions identifiées sur l’Ara h 3 allergène multiple de liaison aux IgE. (une ) La séquence primaire Ara h 3 a été synthétisé sous forme d’acide 15 aminé&# X02013, peptides longs décalés les uns des autres par huit résidus. Ces peptides ont été sondées avec un pool d’IgE sériques d’ .

Pour déterminer la séquence d’acides aminés exacte des régions de liaison aux IgE, des peptides synthétiques (15 acides aminés neutralisés par deux acides aminés) représentant les régions de liaison aux IgE plus importantes ont été générées et sondées avec un pool de sérum d’IgE provenant de patients qui reconnaissent recombinant Ara h 3. Ce processus a permis de distinguer des épitopes IgE individuels dans les grandes régions de liaison aux IgE de l’Ara h 3 protéines. Figure &# X200B; Figure4 4 une est un immunotransfert de six peptides synthétiques, alors que la Fig. &# X200B; Fig.4 4 b représente la séquence d’acides aminés représentant la région et les séquences d’acides aminés représentées par chaque peptide individuel. La zone ombrée de la Fig. &# X200B; Fig.4 4 b représente l’épitope de base. Les quatre liant les IgE epitopes identifiés de cette manière sont présentées dans le Tableau &# X200B; Tableau 1: 1. les épitopes allant de neuf à 13 acides aminés de longueur.

Identification d’un noyau épitope IgE contraignant sur l’Ara h 3 allergène. (une ) Une cartographie détaillée de l’épitope a été réalisée sur des régions de liaison aux IgE par la synthèse de peptides se chevauchant de 15 acides aminés de longueur de décalage à partir du peptide précédent par deux résidus. Ces .

Ara h 3 épitopes IgE liaison

Immunodominance et la caractérisation de l’Ara h 3 epitopes.

Pour déterminer si l’un des quatre épitopes étaient immunodominant (au sein de l’Ara h 3&# X02013; population allergique), chaque ensemble de quatre peptides a été sondé individuellement avec les IgE sériques des huit patients, précédemment présentés à reconnaître Ara recombinant h 3 (résultats résumés dans le tableau &# X200B; Table1 1 comme une reconnaissance de pourcentage). Epitope 1 a été reconnu par les IgE sériques de 25&# X00025; (08/02) des patients testés, tandis que les epitopes 2 et 4 ont été reconnus par les IgE sériques de 38&# X00025; (3/8) des huit patients testés. Fait intéressant, les epitopes 2 et 4 ont été reconnus par les mêmes trois patients. 3 épitope est reconnu par l’IgE sérique de 100&# X00025; (8/8) de l’Ara h 3&# X02013; les patients allergiques, le classant comme un épitope immunodominant dans le Ara h 3&# X02013; population allergique. Soixante-huit pour cent des acides aminés constituant les epitopes étaient soit des résidus non chargés polaires ou apolaires. Cependant, il n’y avait pas de motif de séquence évidente par rapport à la position ou la polarité partagée par les epitopes individuels.

Les mutations au niveau des résidus spécifiques éliminent la liaison aux IgE.

Les acides aminés essentiels pour la liaison des IgE à l’Ara h 3 epitopes ont été déterminées en synthétisant des peptides avec plusieurs changements d’acides aminés uniques à chaque position. Ces peptides ont été sondés avec un pool d’IgE sériques provenant de patients qui avaient déjà reconnu le peptide de type sauvage, pour déterminer si des changements d’acides aminés affectés liaison spécifique à l’arachide IgE. Figue. &# X200B; Fig.5 5 montre une bande immunoblot contenant le type sauvage et peptides mutants pour épitope 4. Le pool d’IgE sériques ne reconnaît pas le peptide, ou une diminution de la liaison a été observée lors de l’alanine a été remplacé par l’acide aminé de type sauvage au positions 308, 309, 310, 311, 312, et 314. Fait intéressant, il semble que si une substitution alanine augmente la liaison aux positions 304 et 305. l’Ara h 3 restants épitopes ont été analysés de la même manière IgE. De manière générale, chaque epitope peut être modifiée à un non&# X02013, le peptide de liaison aux IgE par le remplacement du résidu d’acide aminé de type sauvage en alanine. Les résidus critiques pour la liaison des IgE dans chaque Ara h 3 épitope sont présentées dans le tableau &# X200B; Tableau 2. 2. Il apparaît que les acides aminés centraux dans chaque epitope sont favorisés pour la mutation. Toutes les mutations qui ont conduit à une diminution significative de la liaison des IgE ont été localisés au niveau des résidus trouvés dans chaque épitope de nucléocapside (comme identifié sur la Fig. &# X200B; Fig.4). 4). Il n’y avait pas de consensus évident dans le type d’acide aminé qui, lorsqu’il est muté en alanine, conduit à une perte complète ou une diminution de la liaison aux IgE.

Ara h 3 epitopes peuvent être mutées pour non&# X02013; peptides de liaison aux IgE. Épitopique 4 a été synthétisé par un résidu alanine substitué à l’un des acides aminés à chaque position dans le peptide. Les peptides synthétisés ont été sondées avec un pool d’IgE sériques .

Les acides aminés essentiels pour la liaison des IgE

Discussion

Nous avons rapporté le clonage d’ADNc, l’expression et l’analyse de l’épitope de l’Ara h 3, une protéine 11S, de stockage de l’allergène d’arachide, A. hypogaea. Bien que ceux-ci sont des protéines prédominantes dans les légumineuses, ceci est la première fois que l’ADNc d’une protéine de stockage 11S a été clone et on a montré coder pour une protéine allergène dans l’arachide. 11S protéines de stockage sont initialement synthétisés sous forme de 60 kDa preproglobulins comprenant des polypeptides acides et basiques liés de manière covalente. Les précurseurs sont déposés dans les organes de stockage où ils agrègent en trimères, avant d’être clivée par une endopeptidase asparagine-dépendant (21. 22). Cela se traduit par un groupe NH2 -chaîne acide terminale &# X0223c; 35 kDa et une chaîne de base COOH-terminale de &# X0223c, 20 kDa, qui deviennent ensuite reliés par un pont disulfure (23). 11S protéines de stockage sont ensuite assemblés dans leur forme mature que les oligomères hexamères composé de six sous-unités similaires (24). Ara h 3 représente l’ADNc de la région codant pour la preproglobulin 60 kDa.

Nous avons démontré l’expression de haut niveau de l’Ara h 3 recombinant dans un système bactérien. IgE sériques de 44&# X00025; (8/18) de notre population de patients allergique aux arachides reconnu recombinant Ara h 3, le désignant comme un allergène mineur. Ceci est en contraste avec les autres allergènes d’arachide, Ara h 1, Ara h 2 et, qui sont tous deux allergènes majeurs (25), reconnu par &# X0003e; 90&# X00025; de la population de patients. Tous les trois de ces allergènes partagent des propriétés fonctionnelles similaires; elles sont toutes les protéines d’entreposage des semences sans activité enzymatique. Cependant, aucune preuve directe existe quant à la raison pour laquelle seule une partie de la population de patients reconnaît Ara h 3. La capacité des 11S protéines de stockage pour oligomériser en hexamères et la position des épitopes au niveau tertiaire de la structure des protéines peut donner un aperçu de cette question . Une autre possibilité est le degré de similarité de séquence retenu entre ces protéines provenant de différentes légumineuses. Ara h 3 présente une identité de séquence élevée avec les protéines de stockage de légumineuse de soja et de pois (62&# X00025;&# X02013; 72&# X00025;) que Ara h 1 présente avec vicilines (40&# X00025;) ou Ara h 2 pièces avec conglutinins (39&# X00025;) (14. 15). Le pourcentage de patients avec des IgE spécifiques d’allergènes peut dépendre des séquences uniques non conservées entre des familles de protéines de différentes espèces de légumineuses. Ceci expliquerait le faible pourcentage de patients allergiques à l’arachide avec IgE à Ara h 3 et le plus petit nombre de linéaire, les régions de liaison aux IgE trouvent dans cet allergène. Plusieurs caractéristiques ont été proposées pour justifier des protéines particulières sont allergènes. Ces raisons comprennent leur abondance accrue de l’offre alimentaire, leur durabilité lors de la transformation des aliments (blanchissement), et de leur résistance à la digestion dans le tractus gastro-intestinal (26. 27). Que ces traits jouent un rôle dans pourquoi cette protéine particulière est un allergène mineur doit encore être étudiée.

Étant donné que les IgE spécifiques de l’allergène joue un rôle essentiel dans l’étiologie de la maladie allergique, la détermination de spécifique de l’allergène, les épitopes de liaison aux IgE est une première étape importante vers la compréhension de la complexité des réactions d’hypersensibilité. En générant de synthèse, des peptides chevauchants qui représentent la totalité de la séquence primaire de la protéine, nous avons pu déterminer qu’il y a quatre sites de reconnaissance d’IgE distincts répartis dans la séquence primaire de la protéine. L’un de ces sites (3) épitope a été reconnu par tous les IgE sériques d’Ara h 3&# X02013; le patient allergique, le désignant comme un épitope immunodominant. Fait intéressant, les epitopes 3 et 4 sont situés dans la région hypervariable de la chaîne acide, un étirement d’acides aminés qui est très variable dans la longueur entre 11S des protéines de stockage. Cette région contient une proportion élevée de glutamate, d’aspartate et les résidus d’arginine et tolérer des insertions ou des deletions d’origine naturelle. prédictions informatiques provenant d’autres études suggèrent que cette région est exposée à la surface de la protéine (28), le rendant accessible à la liaison des IgE. Plusieurs épitopes IgE ont été identifiés pour les allergènes de lait de vache (29), morues (30), le noisetier (31), le soja (32), les crevettes (33), et d’autres. L’observation de multiples sites de liaison aux IgE reflète probablement la nature polyclonale de la réponse immunitaire et peut être une étape nécessaire dans l’établissement d’une protéine comme un allergène. En outre, la reticulation de l’IgE sur la surface de l’allergène est nécessaire pour la dégranulation des mastocytes, conduisant à la libération d’histamine et d’autres médiateurs de la réponse immunitaire. Pour la réticulation de se produire, plusieurs sites de liaison aux IgE devraient être présents.

glycinines de soja ont longtemps été la cible d’études de génie génétique visant à améliorer leur valeur nutritive (34 &# X02013; 37). Les expériences initiales ont montré que des mutations dans la sous-unité acide 35 kDa ont peu d’effet sur la capacité des glycinines à oligomériser dans des structures d’ordre supérieur. Nous avons choisi d’alanine pour l’analyse mutationnelle sur la base de sa capacité à être toléré dans les deux &# X003b1; hélice et &# X003b2; structure secondaire en feuillet. Tous les quatre Ara h 3 epitopes se trouvent à l’intérieur de la sous-unité acide 35-kDa. Parce qu’il n’y a pas de chevauchement entre les acides aminés considérés comme importants pour la glycinine structure (20) et les résidus critiques nécessaires à la liaison des IgE, nous sommes convaincus que l’Ara h 3 ADNc peuvent être modifiés pour coder une protéine nonallergenic qui conserve sa structure native et la fonction. Ce gène modifié peut être utilisé pour modifier les plants d’arachide, et la protéine exprimée peut être utilisé pour une immunothérapie recombinante (38).

Actuellement, la seule option thérapeutique disponible pour la prévention des réactions allergiques alimentaires est d’éviter des aliments. Étant donné que l’arachide est utilisé en tant que supplément protéique dans une grande variété d’aliments traités, la consommation accidentelle est presque inévitable (39). Les allergènes recombinants sont des outils prometteurs pour le diagnostic et le traitement des patients hypersensibilité alimentaire. Caractéristiques des allergènes recombinants qui les rendraient utiles dans un contexte clinique comprennent une capacité réduite à se lier aux IgE sériques, assurant un plus faible risque d’effets secondaires anaphylactiques médiées par les IgE, et la rétention de leurs épitopes de cellules T, ce qui permet une modulation de la réponse immunitaire. L’élucidation des principaux epitopes de liaison aux IgE sur l’Ara h 3 et la détermination des acides aminés dans ces epitopes sont critiques pour la liaison des IgE fournit les informations nécessaires pour modifier la Ara h 3 génique par mutagenèse dirigée à coder pour une protéine qui échappe à la reconnaissance des IgE. En raison de l’utilisation extensive de protéines d’arachide dans les aliments de consommation et la gravité potentielle d’une réaction allergique induite par l’arachide, nos futures études sont destinées à la production d’un ADNc qui code pour une protéine de stockage 11S non allergéniques à des fins immunothérapeutiques et transformation stable dans les plantes pour produire une cacahuète hypoallergénique.

Remerciements

Ce travail a été soutenu par la subvention RO1-AI33596 du National Institutes of Health et par la Fondation de recherches sur les allergies Clarissa Sosin.

Les références

1. JJ Jansen et al. La prévalence de l’allergie alimentaire et de l’intolérance dans la population néerlandaise adulte. J Allergy Clin Immunol. 1994; 93: 446-456. [PubMed]

2. Burks AW, Sampson HA. Les allergies alimentaires chez les enfants. Curr Prob Pediatr. 1993; 23: 230-252. [PubMed]

3. Sampson HA. Le rôle de l’allergie alimentaire et la libération de médiateurs dans la dermatite atopique. J Allergy Clin Immunol. 1988; 81: 635-645. [PubMed]

4. James JM, Sampson HA. Un aperçu de l’hypersensibilité alimentaire. Pediatr Allergy Immunol. 1992; 3: 67-78.

5. Sutton BJ, HJ Gould. Le réseau de l’IgE humaine. La nature. 1993; 366: 421-428. [PubMed]

6. Arruda LK, Vailes LD, Platts-Mills TAE, Hayden ML, Chapman MD. Induction d’IgE anticorps réponses par le glutathion S -transférase de la blatte germanique. J Biol Chem. 1997; 272: 20907-20912. [PubMed]

7. Akasawa A, Hsieh LS, Martin BM, Liu T, Lin Y. Un allergène acide roman, Hev b 5, en latex. J Biol Chem. 1996; 271: 25389-25393. [PubMed]

8. Grégoire C, et al. clonage d’ADNc et séquençage révèle le principal cheval allergène Equ c1 d’être membre de la glycoprotéine de la superfamille de lipocaline. J Biol Chem. 1996; 271: 32951-32959. [PubMed]

9. Engel E, et al. Immunological et propriétés biologiques de Bet v 4, un roman allergène du pollen de bouleau avec deux domaines de liaison du calcium EF-main. J Biol Chem. 1997; 272: 28630-28637. [PubMed]

10. Gibbs PEM, Strongin KB, McPherson A. Evolution des protéines de stockage de semences de légumineuses&# X02014; un domaine commun à légumines et vicilines est dupliqué dans vicilines. Mol Biol Evol. 1989; 6: 614-623. [PubMed]

11. Broadbent JB, Sampson HA. Cross-allergénicité dans la famille botanique des légumineuses chez les enfants présentant une hypersensibilité alimentaire. J Allergy Clin Immunol. 1989; 84: 701-709. [PubMed]

12. Eigenmann PA, Burks AW, Bannon GA, Sampson HA. Identification de l’arachide et de soja allergènes uniques dans les sérums adsorbés avec des anticorps à réaction croisée. J Allergy Clin Immunol. 1996; 98: 969-978. [PubMed]

13. Burks AW, Cockrell G, Stanley JS, Helm RM, Bannon GA. Recombinant allergène d’arachide Ara h 1 expression et de liaison aux IgE chez les patients présentant une hypersensibilité à l’arachide. J Clin Invest. 1995; 96: 1715-1721. [Article PMC gratuit] [PubMed]

14. Stanley JS, et al. Identification et analyse mutationnelle des épitopes IgE immunodominants de la grande arachide allergène Ara h 2. Arc Biochem Biophys. 1997; 342: 244-253. [PubMed]

15. Burks AW, et al. Cartographie et analyse mutationnelle des épitopes IgE sur Ara h 1, une protéine légumineuse viciline et un allergène majeur dans l’hypersensibilité à l’arachide. Eur J Biochem. 1997; 245: 334-339. [PubMed]

16. Burks AW, et al. Identification d’un allergène majeur de l’arachide, Ara h 1, chez les patients atteints de dermatite atopique et le défi d’arachide positif. J Allergy Clin Immunol. 1991; 88: 172-179. [PubMed]

17. Sanger F, Nicklen S, Coulson AR. Le séquençage d’ADN avec des inhibiteurs de terminaison de chaîne. Proc Natl Acad Sci USA. 1977; 74: 5463-5467. [Article PMC gratuit] [PubMed]

18. Devereux J, Haeberli P, Smithies O. Un ensemble complet de programmes d’analyse de séquence pour le VAX. Nucleic Acids Res. 1984; 12: 387-395. [Article PMC gratuit] [PubMed]

19. Tobias JW, Shrader TE, ROCAP G, règle Varshavsky A. L’extrémité N-terminale dans des bactéries. Science. 1991; 254: 1374-1377. [PubMed]

20. Bairoch A, Bucher P. PROSITE: développements récents. Nucleic Acids Res. 1994; 22: 3584-3589. [Article PMC gratuit] [PubMed]

21. Tumer NE, Richter JD, Nielsen NC. Caractérisation structurale des précurseurs glycinine. J Biol Chem. 1982; 257: 4016-4018. [PubMed]

22. Barton KA, et al. Et le traitement de la biosynthèse des précurseurs de poids moléculaire élevé de sous-unités de soja glycinine. J Biol Chem. 1982; 257: 6089-6095. [PubMed]

23. Staswick PE, Hermodson MA, Nielsen NC. L’identification des complexes de sous-unités glycinine acides et basiques. J Biol Chem. 1981; 256: 8752-8755. [PubMed]

24. Staswick PE, Hermodson MA, Nielsen NC. La séquence d’acides aminés de la sous-unité A2B1a de glycinine. J Biol Chem. 1984; 259: 13431 à 13435. [PubMed]

25. Shin DS, et al. L’analyse biochimique et structurale des sites de liaison aux IgE sur Ara h 1 et la protéine d’arachide abondantes et très allergiques. J Biol Chem. 1998; 273: 13753-13759. [PubMed]

26. Astwood JD, Leach JN, Fuchs RL. Stabilité des allergènes alimentaires à la digestion in vitro. Nat Biotechnol. 1996; 14: 1269 à 1273. [PubMed]

27. Veiths, S. Aulepp, J. Becker, W.M. et Buschmann, L. 1996. Caractérisation des allergènes labiles et stables dans les aliments d’origine végétale. Dans allergies et intolérances alimentaires. G. Eisenband, H. Aulepp, A.D. Dayan, P.S.Elias et W. Grunow, éditeurs. VCH Verlagsgesellschaft. Weinheim, Allemagne. 130&# X02013; 149.

28. Nielsen, N.C. Scott, p.f. et Lago, W.J.P. 1990. propriétés Assemblée de sous-unités modifiées dans la famille des sous-unités de la glycinine. Dans Institut d’étude avancée de l’OTAN sur la biologie moléculaire végétale. R. Hermann et B. Larkins, éditeurs. Plenum Press. New York, NY. 635&# X02013; 640.

29. Balle G, et al. Un épitope continu majeur de la bêta-lactoglobuline bovine reconnue par IgE humaine de liaison. Clin Exp Allergy. 1994; 24: 758-764. [PubMed]

30. Aas K, propriétés Elsayed S. physico-chimiques et de l’activité spécifique d’un allergène purifié (morues) Dev Biol Stand. 1975; 29: 90-98. [PubMed]

31. Elsayed S, Holen E, Dybendal T. épitopes allergènes synthétiques des régions amino-terminales des allergènes majeurs de noisette et le pollen de bouleau. Int Arche Allergy Immunol Appl. 1989; 89: 410-415. [PubMed]

32. Herian AM, Taylor SL, Bush RK. Identification des allergènes de soja par immunoblot avec des sérums d’adultes de soja-allergique. Int Arche Allergy Immunol Appl. 1990; 92: 193-198. [PubMed]

33. Shanti KN, Martin BM, Nagpal S, Metcalfe DD, Rao PV. Identification de tropomyosine comme l’allergène majeur de la crevette et la caractérisation de ses épitopes IgE. J Immunol. 1993; 151: 5354-5363. [PubMed]

34. Utsumi S, et al. La synthèse, le traitement et l’accumulation des glycinines modifiées de soja dans les graines, les feuilles et les tiges de tabac transgénique. Usine Sci. 1993; 92: 191-202.

35. Utsumi S, Katsube T, T Ishige, conception Takaiwa F. moléculaire de glycinines de soja avec des qualités alimentaires et le développement des cultures produisant de tels glycinines. Adv Exp Med Biol. 1997; 415: 1-15. [PubMed]

36. Dickinson CD, Scott MP, Hussein EH, Argos P, Nielsen NC. Effet des modifications structurelles sur l’assemblage d’une sous-unité de glycinine. Cellule de plante. 1990; 2: 403-413. [Article PMC gratuit] [PubMed]

37. Lawrence MC, Izard T, Beuchat M, Blagrove RJ, Colman PM. Structure de phaséoline à 2.2 Une résolution. Implications pour une structure commune de viciline / légumine et le génie génétique des protéines de stockage des semences. J Mol Biol. 1994; 238: 748-776. [PubMed]

38. Ferreira F, et al. La modulation de la réactivité des IgE des allergènes par mutagenèse dirigée: utilisation potentielle des variants hypoallergéniques pour l’immunothérapie. FASEB J. 1998; 12: 231-242. [PubMed]

39. Sicherer SH, Burks AW, Sampson HA. Les caractéristiques cliniques des réactions allergiques aiguës à l’arachide et les noix chez les enfants. Pédiatrie. 1998; 102: 6-16. [PubMed]

Les articles de The Journal of Clinical Investigation sont offerts à titre gracieux de American Society for Clinical Investigation

RELATED POSTS

  • Biologie moléculaire des épidermoïde …

    La biologie moléculaire du carcinome épidermoïde de la tête et du cou B Perez # X02010; Ordo # X000f1; Ez . Département de pathologie, Réseau universitaire de santé, et le Département de…

  • JCI – La pathogenèse moléculaire …

    La pathogenèse moléculaire de la tête et du cou carcinome spinocellulaire Publié 1 Juin, 2012 Le carcinome épidermoïde de la tête et du cou (CETC) est un cancer humain relativement fréquente…

  • Pathologie moderne – Mise à jour sur les petites …

    Cours de longue Article Pathologie moderne (2012) 25, S18 # X02013; S30; doi: 10.1038 / modpathol.2011.150 Mise à jour sur le carcinome à petites cellules et sa différenciation d’un carcinome à…

  • À long terme de suivi de microvasculaire …

    À long terme de suivi de microvasculaire Décompression pour névralgie du trijumeau Abstrait Nous avons mené une étude pour évaluer les caractéristiques de suivi des patients atteints de…

  • hystérectomie subtotale laparoscopique

    Laparoscopique supracervicale hystérectomie Par rapport au total hystérectomie Département d’obstétrique et de gynécologie, Unité opérationnelle de Gynécologie, Azienda Ospedaliera…

  • Hôpital Epidemiology and Infection …

    Hôpital d’épidémiologie et de contrôle des infections dans les établissements de soins actifs Abstrait Résumé: Les infections associées aux soins de santé (IASS) sont devenus plus fréquents que…

Laisser un commentaire